![]() As the patient had intermittently experienced this diarrhea, she had been previously undergone cholecystectomy, and repeated histopathological investigation of the gallbladder biopsy had demonstrated acalculous cholecystitis with non-specific inflammations. Prior to fecal microscopic examination in author’s laboratory, she had a history of intermittent diarrhea that was variably associated with nausea, vomiting, loss of appetite, and weight loss for 6 months. Sarcocystis-positive diarrheal sample was from a woman with AIDS and a CD4 + count of less than 100 cells/μl. In addition to microscopic examinations, semi-nested PCR analyses were performed to confirm whether isolated oocysts were of other protozoans (e.g., Cryptosporidium, Cystoisospora belli, and Cyclospora cayetanensis), as previously reported. All the microscopic-negative fecal samples were also ruled out using DNA extraction and the same primers. Neospora caninum was used as the outgroup. cruzi and other species in the genus Sarcocystis, a phylogenetic analysis of 18S rDNA was performed using CLC Sequence Viewer 6 software ( ). For better understanding of relationship among S. The sequence was compared with sequences in the GenBank database by BLAST analysis. PCR product was directly sequenced with the set of primers 2L and 3H used for the secondary step. Amplification product was analyzed by electrophoresis through a 2% agarose gel for the Sarcocystis-specific PCR. The templates were subjected to 30 amplification cycles (94˚C for 40 sec, 53˚C at primary PCR and 56˚C at secondary PCR for 60 sec, 72˚C for 100 sec at primary PCR and 80 sec at secondary PCR) followed by 1 cycle 7 min at 72˚C and held at 4˚C. The outer primers were 2L (GGATAAACCGTGGTAATTCTATG) and 2H (ACCTGTTATTGCCTCAAACTTC) and the inner primers were 2L and 3H (GGCAAATGCTTTCGCAGTAG). A fragment of the 18S rDNA gene was amplified using a semi-nested PCR procedure, as previously described and reported in previous investigations in the laboratory. DNA extracted was then frozen at -20˚C until use for molecular studies. Key words: Sarcocystis cruzi, PCR, sporocyst, diarrhea, human, AIDSįor molecular identification, DNA was extracted from harvested sporocysts using proteinase K digestion, and phenol-chloroform purification followed by ethanol precipitation method as previously described. To the best of our knowledge, this is the first report of S. Sarcocystis-like sporocysts found from a woman were identified as Sarcocystis cruzi through 18S rDNA amplification and phylogenetic analysis. Isospora belli), 2 Cyclospora cayetanensis, and 15 microsporidia ( Enterocytozoon bieneusi). Oocysts-positive samples were 68 Cryptosporidium spp., 9 Cystoisospora belli (syn. Diarrheal samples of 741 immunodeficient patients with recurrent persistent or chronic diarrhea were examined by microscopy and molecular biological analysis. This study aimed to address how to detect and differentiate Sarcocystis oocysts and/or sporocysts from enteric protozoans in the diarrheal samples of immunodeficient patients in Shiraz, Iran. It might be expected that species for which humans are the final host ( Sarcocystis hominis and Sarcocystis suihominis as well as possibly others) would be encountered increasingly often in immunodeficient persons. The genus Sarcocystis is not usually considered as an important enteric pathogen in immune compromised patients. ![]()
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |